View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_low_101 (Length: 227)
Name: NF16904_low_101
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_low_101 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 49933205 - 49932997
Alignment:
| Q |
1 |
aaggttatgatgtagaagcagagtcttttaagggagctttgatatcaacctgaaagggaaatgatgtaataaagttgaatagtatattttgtgattttga |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49933205 |
aaggttatgatgtacaagcagagtcttttaagggagctttgatatcaacctgaaagggaaatgatgtaataaagttgaatagcatattttgtgattttga |
49933106 |
T |
|
| Q |
101 |
aagtacaggctatgaccaatctttgaaagcacctatctctctgcatagccgnnnnnnncatttctaaattctaaaatagtaactagccaagcatcccaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49933105 |
aagtacaggctatgaccaatctttgaaagcacctatctctctgcatagccgaaaaaaatatttctaaattctaaaatagtaactagccaagcatcccaaa |
49933006 |
T |
|
| Q |
201 |
cgaaataat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
49933005 |
cgaaataat |
49932997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University