View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_low_104 (Length: 210)
Name: NF16904_low_104
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_low_104 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 97
Target Start/End: Complemental strand, 49933971 - 49933885
Alignment:
| Q |
11 |
cgaagaatattttaaggttgctttcttagttgttggtgtacgtatatatgataattgaatctaaaatattattgagttttggcaata |
97 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49933971 |
cgaaaaatattttaaggttgctttcttagttgttggtgtacgtagatatgataattgaatcaaaaatattattgagttttggcaata |
49933885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 49933854 - 49933792
Alignment:
| Q |
128 |
acacattatccttattcaatatcacacttgtcagtggccaggttgactcccagttgcaaataa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49933854 |
acacattatccttattcaatatcacacttgtcagtggccaggttgactcccagttgcaaataa |
49933792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University