View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_low_54 (Length: 330)
Name: NF16904_low_54
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 32 - 320
Target Start/End: Complemental strand, 56294469 - 56294171
Alignment:
| Q |
32 |
atatattagacaaaaacacgagtatggagaggacttgacattgaacctgaagggtccactatgaaaccgttgga----------tccattccatttaatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
56294469 |
atatattagacaaaaacacgagtatggagaggacttgacattgaacctgaagggtccactatgaaaccgttggattggatccattccatttcatttaatt |
56294370 |
T |
|
| Q |
122 |
taatgggatacaaatccaaatcaaagtaatgaccagtcaagaatttgaccatctgactgattcttgaccctctgactctgcatttattctcacctctaaa |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56294369 |
taatgggatccaaatccaaatcaaagtaatgaccagtcaagaatttgaccatctgactgattcttgaccctctgactctgcatttattctcacctctaaa |
56294270 |
T |
|
| Q |
222 |
attttaaaagactttggaactaacttattgttggatggtctggttgaacacaaaaagaaaaagtgtctcactcatcaattgctttgtttttcatctgtg |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56294269 |
attttaaaagactttggaactaacttattgttggatggtctggttgaacacaaaaagaaaaagtgtctcactcttcaattgctttgtttttcatctgtg |
56294171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University