View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_low_75 (Length: 277)
Name: NF16904_low_75
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 58 - 258
Target Start/End: Original strand, 49014757 - 49014957
Alignment:
| Q |
58 |
ggaggtaaacaggatgcttctatatgcaactaaggaaagggggaaaaaataacagcacaagagagccccctgcactgattttatacattgcttatgaatt |
157 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49014757 |
ggaggtaaacatgatgcttctatatgcaactaaggaaaggggaaaaaaataacagcacaagagagccccctgcactgattttatacattgcttatgaatt |
49014856 |
T |
|
| Q |
158 |
tcaagattaatcggtaacaacaaaatcaacttgttaactaaactatataattgaagcaacgctctaaaaatgaaattagggaaacagtgaaaggactgga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49014857 |
tcaagattaatcggtaacaacaaaatcaacttgttaactaaactatataattgaagcaacgctctaaaaatgaaattagggaaacagtgaaaggactgga |
49014956 |
T |
|
| Q |
258 |
g |
258 |
Q |
| |
|
| |
|
|
| T |
49014957 |
g |
49014957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 98
Target Start/End: Complemental strand, 2308614 - 2308574
Alignment:
| Q |
58 |
ggaggtaaacaggatgcttctatatgcaactaaggaaaggg |
98 |
Q |
| |
|
|||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
2308614 |
ggaggtaatcatgatgctactatatgcaactaaggaaaggg |
2308574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University