View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16904_low_95 (Length: 238)
Name: NF16904_low_95
Description: NF16904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16904_low_95 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 662270 - 662047
Alignment:
| Q |
18 |
ggaagttttaatatgatccaaaactctagacaatttggacgtataagatatacctttaattctttatttcaagcaacgtgagacttattctctggcaca- |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
662270 |
ggaagttttaatattatccaaaactctagacaatttggacgtataaattatacctttaattctttatttcaagcaacgtgagacttattctctggcacac |
662171 |
T |
 |
| Q |
117 |
-gagtttagagctattggcattaa-tatcaaatttccagcaacactttcttcatgcattatgtgtttttaacatagagaaactgccttttttcttgtatt |
214 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
662170 |
agagtttagaactattggcattaaatatcaaatttccagcaacactttcttcatgcattaagtgtttttaacatagagaaactgccttttttcttatatt |
662071 |
T |
 |
| Q |
215 |
gcttgtaacatgctaagacataat |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
662070 |
gcttgtaacatgctaagacataat |
662047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University