View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16905_high_18 (Length: 361)
Name: NF16905_high_18
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16905_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 8734729 - 8734557
Alignment:
| Q |
19 |
ataatgcacttccatgcaattataaaacggttacatttataaaaaa-tcttgtatggtgtgaaaaagttagaaaacggtgagttcaatttt-taattttt |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
8734729 |
ataatgcacttccatacaattataaaacggttacatttataaaaaaatcttgtatagtgtgaaaaagttagaaaacggtgagttcaattttatttttttt |
8734630 |
T |
 |
| Q |
117 |
attggaaatggtcaatcgaccaacccnnnnnnnncctatgtttgttgctataatcttagtgtaataagtatga |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8734629 |
attggaaatggtcaatcgaccaaccctttcttttcctatgtttgttgctataatcttagtgtcataagtatga |
8734557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University