View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16905_high_23 (Length: 308)
Name: NF16905_high_23
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16905_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 17 - 292
Target Start/End: Original strand, 39584177 - 39584452
Alignment:
| Q |
17 |
atcaacttatcagcttctccttctttgtcaaatctctctggcttgaattgtgttgggtcactccatagttgagaatctctgtgaattgcccaagcattaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39584177 |
atcaacttatcagcttctccttctttgtcaaatctctctggcttgaattgtgttgggtcactccatagttgagaatctctgtgaattgcccaagcattaa |
39584276 |
T |
 |
| Q |
117 |
ccaataaaatagtgttttttgggacattataacctcctatggtgcaatcttgtgaagaaaaatgaggagccaacaatgcaaatgcaggatgcaatcgaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39584277 |
ccaataaaatagtgttttttgggacaatataacctcctatggtgcaatcttgtgaagaaaaatgaggagccaacaatgcaaatgcaggatgcaatcgaaa |
39584376 |
T |
 |
| Q |
217 |
tgtctcgtggattatattttgtaggtaggggagttttgaaatgtctgactcttctactaagtgatcttgtcctatg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39584377 |
tgtctcgtggattatattttgtaggtaggggagttttgaaatgtctgactcttctactaagtgatcttgtcctatg |
39584452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University