View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16905_high_28 (Length: 273)
Name: NF16905_high_28
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16905_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 24 - 265
Target Start/End: Complemental strand, 3945689 - 3945448
Alignment:
| Q |
24 |
agtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcctcagatgaatacta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945689 |
agtagtaactcttgtgatgtgaatcttccattctcaaggttcaatatctctagactctcaacaagttcaggttatgattttcagcctcagatgaatacta |
3945590 |
T |
 |
| Q |
124 |
ttggattaggcttttcatccgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggttcaatctttagttc |
223 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945589 |
ttggattaggcttttcatctgggtttacgtccagtgaagccaatgatcataatggttatacaaatggatttacttcaagatatggttcaatctttagttc |
3945490 |
T |
 |
| Q |
224 |
ttcttctgtaccaagtaatgcatcagttatgccctctctgct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3945489 |
ttcttctgtaccaagtaatgcatcagttatgccttctctgct |
3945448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University