View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16905_high_32 (Length: 250)
Name: NF16905_high_32
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16905_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 36541778 - 36541537
Alignment:
| Q |
1 |
aacaataaacatggagctatgtgaaatcactctaagatctcaagatgagcaattggttttcaataatttggaaacaaggaaatatccacaac---ttggg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
36541778 |
aacaataaacatggagctatgtgaaatcactctaagatctcaagatgagcaagtggttttcaataatttggaattaaggaaatatccacaacgacttggg |
36541679 |
T |
 |
| Q |
98 |
tgatggtacgtccaactagtgatgtaaaagaaatgttgcatagaaggaaatccatgggttatagtcaaatttctttttagtaactttgtatttgacgatg |
197 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
36541678 |
tgatggtacgtccaactagagacgtaaaagaaatgttgcataggaggaaattcatgggttatagtcaattttctttttagtaactttgtctttgacgatg |
36541579 |
T |
 |
| Q |
198 |
tcagttttctgttatgtatgtgttgaatattgtttatttctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36541578 |
tcagttttctgttatgtatgtgttgaatattgtttatttctt |
36541537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University