View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16905_low_14 (Length: 417)
Name: NF16905_low_14
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16905_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 230 - 400
Target Start/End: Complemental strand, 42158265 - 42158096
Alignment:
| Q |
230 |
tgttgattctaggccggacaccattattgaggggcgaaccttggggtctccacttatgtttgtgagtttacaacaactattatcatttcgtctatcnnnn |
329 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42158265 |
tgttgattctaggctggacaccatcactgaggggcgaaccttggcgtctccacttatgtttgtgagtttacaacaattattgtcatttcgtctatccata |
42158166 |
T |
|
| Q |
330 |
nnnnnnnnnnnnnnnnttcaactaatgctcttcagagttcagatacaatgattttgactatatatgaatgg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42158165 |
aacaaacaaacaaaaattcaactaatgctcttcagagttcagatacaatga-tttgactatatatgaatgg |
42158096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 42158511 - 42158452
Alignment:
| Q |
1 |
tatcatcttaagtatgttacggaagataggaaagctgtttccgatgccagaaagtctttg |
60 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158511 |
tatcatcttaaggttgttaccgaagataggaaagctgtttccgatgccagaaagtctttg |
42158452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 277 - 325
Target Start/End: Complemental strand, 4429991 - 4429944
Alignment:
| Q |
277 |
ctccacttatgtttgtgagtttacaacaactattatcatttcgtctatc |
325 |
Q |
| |
|
|||||||||||| |||||||||| || |||| ||||||||||||||||| |
|
|
| T |
4429991 |
ctccacttatgtgtgtgagtttataataact-ttatcatttcgtctatc |
4429944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University