View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16905_low_31 (Length: 300)
Name: NF16905_low_31
Description: NF16905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16905_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 80777 - 80521
Alignment:
| Q |
20 |
atttgtatcatccgaaaatatactttcaaacaatttgtccaaaactgcatcaaataaaatacaatttgtcaaaaattatgcatattagcagatcaacatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80777 |
atttgtatcatccgaaaatatactttcaaacaatttgtccaaaactgcatcaaataaaatacaatttgtcaaaaattatgcatattagcagatcaacatt |
80678 |
T |
 |
| Q |
120 |
gcttacactttggttgg------acnnnnnnnngaggcttaaaattatgagtttttgctcggttaattttctgaatagtgtgtgaatctccctttggttt |
213 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
80677 |
gcttacactttggttggaaaaaaaaaaaaaaaagaggcttaaaattatgagtttttgctcggctaattttctggatagtgtgtgaatctccctttggttt |
80578 |
T |
 |
| Q |
214 |
ccttcttcatgacatgatttgcgacaaattttttggagcgtaactccacgatgatca |
270 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80577 |
ccttcttcatgacattatttgcgacaaattttttggagcgtaactccacgatgatca |
80521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University