View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16906_high_5 (Length: 386)
Name: NF16906_high_5
Description: NF16906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16906_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 101 - 367
Target Start/End: Original strand, 38611715 - 38611981
Alignment:
| Q |
101 |
aaatgttttgctaatatccctaattgaagatgaactgtttgaatctgatttagaactccttgatgtagacccgtgaatttgataagagctaaaacaacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38611715 |
aaatgttttgctaatatccctaattgatgatgaactgtttgaatctgatttagaactccttgatgtagacccgtgaatttgataagagctaaaacaacca |
38611814 |
T |
 |
| Q |
201 |
cttcagtccttcacctcaaaatctagcgtnnnnnnnnnnnnnnnnnnntggctgtggatatctcaatgtttttgtttccaataatttactcttaacttac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38611815 |
cttcagtccttcacctcaaaatctagcgtaacaacaacaacaacaaactggctgtggatatctcaatgtttttgtttccaataatttactcttaacttac |
38611914 |
T |
 |
| Q |
301 |
ttgtataataactatgcaggtcgggaataacatgtatttttgtaatcggaaggagaaggtcaacttt |
367 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38611915 |
ttgtataataactatgcaggtggggaataccatgtatttttgtaatcggaaggagaaggtcaacttt |
38611981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 105 - 169
Target Start/End: Original strand, 34722165 - 34722229
Alignment:
| Q |
105 |
gttttgctaatatccctaattgaagatgaactgtttgaatctgatttagaactccttgatgtaga |
169 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
34722165 |
gttttgctaatatccctagttggtgatgaactgattgaatctgatttcgaactccctgatgtaga |
34722229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 165
Target Start/End: Original strand, 34731457 - 34731519
Alignment:
| Q |
103 |
atgttttgctaatatccctaattgaagatgaactgtttgaatctgatttagaactccttgatg |
165 |
Q |
| |
|
||||||||||| ||| |||| || | |||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
34731457 |
atgttttgctattattcctatttaacgatgaactatttgaagctgattttgaactccttgatg |
34731519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University