View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16906_low_1 (Length: 451)
Name: NF16906_low_1
Description: NF16906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16906_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 17343729 - 17344013
Alignment:
| Q |
19 |
atgtagaccctaatgcactattcctcgttagaaacatatttatccttttgtaccgaaaaagaaaaacacattttcatccctaattaatgatatgcttaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17343729 |
atgtagaccctaatgcactattcctcgttagaaacatatttatccttttgtaccaaaaaagaaaaacacattttcatccctaattaatgatatgcttaat |
17343828 |
T |
 |
| Q |
119 |
caggttaacttcttcacatgnnnnnnnnnnnnnnacaagcttcttcacatgctgatgcacatataatgcatatatcattgttaattataaagtaaaaact |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17343829 |
caggttaacttcttcacatgtttttgtttttctaacaagcttcttcacatgctgatgcacatataatgcatatatcattgtta----taaagtaaaaact |
17343924 |
T |
 |
| Q |
219 |
aatttaaaccttggataaaagctacatatggaatgactaatgagtaactttagaggttaaaattattattttatatcattgttaacaca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17343925 |
aatttaaaccttggataaaagctacatatgtaatgactaatgagtaactttagaggttaaaattattattttatatcattgttaacaca |
17344013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 361 - 444
Target Start/End: Original strand, 17344067 - 17344150
Alignment:
| Q |
361 |
gcaaattacttccagctccataattttttagataaatttgttattattttggctatggattcttttgcttttaatttcttctct |
444 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17344067 |
gcaaattccttccagctccatagttttttaggtaaatttattattattttggctatggattcttttgcttttaattttttctct |
17344150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University