View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16908_low_3 (Length: 239)
Name: NF16908_low_3
Description: NF16908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16908_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 12359542 - 12359745
Alignment:
| Q |
17 |
caaaggtttgggtgaaggtgatgcattggttgagatttactttcattactccgcctaannnnnnnaactatttggattgttggacagcacaatggaggtc |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12359542 |
caaaggtttgggtgaaggtgattcattggttgagatttactttcattactccgcctaatttttttaactatttggattgttggacagcacaatggaggtc |
12359641 |
T |
 |
| Q |
117 |
taagaaaattagacaggggttttggtagatttggcatgcttgtattttggtgatttggagggaaagaagcgagtctttaatgatcgctcaaaggaggtta |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12359642 |
taagaaaattagacaggggttttggttgatttggcatgcttgtattttggtgatttggagggaaagaagcgagtctttaatgatcgcttaaaggaggtta |
12359741 |
T |
 |
| Q |
217 |
atga |
220 |
Q |
| |
|
|||| |
|
|
| T |
12359742 |
atga |
12359745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University