View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16909_low_12 (Length: 205)
Name: NF16909_low_12
Description: NF16909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16909_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 9070190 - 9070367
Alignment:
| Q |
15 |
tatgatagaagagtaacaatatgaagttgtttgatccatatacctaagtttatttggtggggtaaaatttagttgaagttgtataaactcttgtataatt |
114 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9070190 |
tatgatagcagagtaacattatgacgttgtttgatccatatacctaagtttatttggtggggtaaaatttagttgaagttgtataaactcttgtatactt |
9070289 |
T |
|
| Q |
115 |
tattttaatacgtgactaactaaaaattattttctttcatgttcgttatcatgtaaaaagtcttaattatgatgattt |
192 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9070290 |
tattttaatacatgacaaactaaaatttattttctttcatgttcgttatcatgtaaaaaggcttaattatgatgattt |
9070367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University