View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16909_low_6 (Length: 253)
Name: NF16909_low_6
Description: NF16909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16909_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 13393844 - 13393606
Alignment:
| Q |
1 |
tttatcccaatagtattggttgggacgcggaaagagtattaacaaattttcgcttccccctaacaacttaattactaacatttgcatataaaaagacatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13393844 |
tttatcccaatagtattggttgggacgcggaaagagtattaacaaattttcgcttccccctaacaacttaattactaacatttgcatataaaaagacatc |
13393745 |
T |
 |
| Q |
101 |
gttatnnnnnnnnnttgtacctcggaacgtgtggcttcggctatgagacacaagatgaagcaaagtaagcctaatagaattgtgaaaaccataagaaaag |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13393744 |
gttattaaaaaaaattgtacctcggaacgtgtggcttcggctatgagacacaggatgaagcaaagtaagcctaatagaattgtgaaaaccataagaaaag |
13393645 |
T |
 |
| Q |
201 |
ctcctgttttgctactcaaatctgttttacttctttttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13393644 |
ctcctgttttgctactcaaatctgttttacttctttttg |
13393606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 232
Target Start/End: Complemental strand, 13396674 - 13396611
Alignment:
| Q |
166 |
taagcctaatagaattgtgaaaaccataagaaaagctcctgttttgctactcaaatctgttttactt |
232 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
13396674 |
taagcctaatataattgtgataac---aagaaaaactactgttttactactcaaatctgttttactt |
13396611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University