View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_21 (Length: 375)
Name: NF1690_high_21
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 249
Target Start/End: Complemental strand, 11345811 - 11345570
Alignment:
| Q |
7 |
aatattgttacaaacttctctccaatctgtttatgaggtaaggataggaggaggtgagacagttatagattgggtagctggaggtgtacgtaagtcttgg |
106 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11345811 |
aatattgttacaa-cttctctccgatctgtttgtgaggtaaggataggaggaggtgagacagttataggttgggtagctggaggtgtacgtaagtcttgg |
11345713 |
T |
|
| Q |
107 |
tttggttgagaagttaaggatgagggtaagtcttggtttctgttgacaatgataataggaataccttcatcatcagaatctgatagttccatgttattag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11345712 |
tttggttgagaagttaaggatgagggtaagtcttggtttctgttgacaatgataacaggaataccttcatcatcagaatctgatagttccatgttattag |
11345613 |
T |
|
| Q |
207 |
tagcagtgtcaacagaggctgggttaaaaacacgttcaaggat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11345612 |
tagcagtgtcaacagaggctgggttaaaaacaggttcaaggat |
11345570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University