View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_22 (Length: 371)
Name: NF1690_high_22
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 218
Target Start/End: Original strand, 41592392 - 41592604
Alignment:
| Q |
6 |
agatatcacaatctaagaggatgcatatggttttacttctgcagtcactttacaagataatttaaacaccgaaagcttttgttctgcatttttaaaatgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592392 |
agatatcacaatctaagaggatgcatatggttttacttctgcagtcactttacaagataatttaaacaccgaaagcttttgttctgcatttttaaaatgc |
41592491 |
T |
 |
| Q |
106 |
aatctgattaccctgcacaatttgattgtgatgtttatgctttacattatggtttagttgctgttcaatgcaatcaaagtattgagtttggtcacttctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41592492 |
aatctgattaccctgcacaatttgattgtgatgtttatgctttacattatggtttagttgctgttcaatgcagtcaaagtattgagtttggtcacttctt |
41592591 |
T |
 |
| Q |
206 |
taatagttcaatc |
218 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41592592 |
taatagttcaatc |
41592604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 286 - 360
Target Start/End: Original strand, 41592672 - 41592746
Alignment:
| Q |
286 |
gcacaaatcatttgatcaatataattttatatgaattatactctcatttgagttgtaaagctcttttttatctct |
360 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41592672 |
gcacaaatcatttgatcaatataatttcatatgaattatactctcatttgagttgtaaagctcttttttatctct |
41592746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 31072243 - 31072187
Alignment:
| Q |
296 |
tttgatcaatataattttatatgaattatactctcatttgagttgtaaagctctttt |
352 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||| ||||||||| | |||||||||||| |
|
|
| T |
31072243 |
tttgatcaatataagtttctatgaatttaactttcatttgagctataaagctctttt |
31072187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University