View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_62 (Length: 251)
Name: NF1690_high_62
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 10 - 153
Target Start/End: Original strand, 6447524 - 6447667
Alignment:
| Q |
10 |
ataattcttacttaagttgcatgtaagttacttagagagatcactatcttttgaaagagaaatgataccttaacatcaaagtttcgatatgtcaaatata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6447524 |
ataattcttacttaagttgcatgtaagttacctagagagatcactatcttttgaaagagaaatgataccttaacatcaaagtttcgatatatcaaatatg |
6447623 |
T |
 |
| Q |
110 |
tttattgtcatttggttcttaaatgtaattttaaaatgcgtgta |
153 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6447624 |
tttattgtcatttggttcttacatgtaattttaaaatgcgtgta |
6447667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University