View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_64 (Length: 249)
Name: NF1690_high_64
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 6 - 178
Target Start/End: Original strand, 42814429 - 42814600
Alignment:
| Q |
6 |
gtcgaataatattataatgtataacaaagttttctttcaatagatctaacattgttcatctgttttctaaactgaataataggaattcagacctcttgtt |
105 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42814429 |
gtcgagtaaaattataatgtataacaaagttttctttcgatagatctaacactgttcatctgttttctaaactgaataataggaattcagacctcttgtt |
42814528 |
T |
 |
| Q |
106 |
aaaccgaaaataatctctttacactctcatgcaattgctctttggtgtattttcttttgtgtcataagagcag |
178 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42814529 |
aaattgaaaataatctctttacactctcatgcaa-tgctctttggtgtattttcttttgcgtcataagagcag |
42814600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University