View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_65 (Length: 248)
Name: NF1690_high_65
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 239
Target Start/End: Original strand, 19292120 - 19292350
Alignment:
| Q |
5 |
gaggagatgtcctaaatgcaaattctatgttgccaaatctttaggcagtaactacatgacatgcaggttgcctttctatttaatcttctcttgctttgcg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292120 |
gaggagatgtcctaaatgcaaattctatgttgccaaatctctaggcagtaactacatgacatgcaggttgcctttctatttaatcttctcttgctttgcg |
19292219 |
T |
|
| Q |
105 |
atcgatttcctgaatatataatattaaacaataattagggcaattttcaatctaaagagggactaaaatgagcaataagtttcaattttagtaacatgag |
204 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292220 |
at----ttcctgaatatataacattaaacaataattagggcaattttcaatctaaagagggactaaaatgagcaataagtttcaattttagtaacatgag |
19292315 |
T |
|
| Q |
205 |
acaagagagagtttagtgaagctttcaatattatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292316 |
acaagagagagtttagtgaagctttcaatattatt |
19292350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University