View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_84 (Length: 217)
Name: NF1690_high_84
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 17856720 - 17856629
Alignment:
| Q |
13 |
attattctattaaaaaacacgacgaacattttcatcatacttcactgtaatacgataatagcatatgtctgtaaaaacagtttttaaaatca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17856720 |
attattctattaaaaaacacgacgaacattttcatcatacttcactgtaatacgataatagcatatgtctgtaaaaacagtttttaaaatca |
17856629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 114 - 193
Target Start/End: Complemental strand, 17856031 - 17855952
Alignment:
| Q |
114 |
taggtttttgtatctggttaggtcttgatttgggaatgaacccaggggttctatttacagtgtttctggccccctttagc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17856031 |
taggtttttgtatctggttaggtcttgatttgggaatgaacccaggggttctatttacagtgtttctggccccctatagc |
17855952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University