View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_high_86 (Length: 209)
Name: NF1690_high_86
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_high_86 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 46655139 - 46655311
Alignment:
| Q |
16 |
attctcagtgacatggttcaggcaaaggcactgatgtagtggaggttaggcttgaccacgtcacagattttcaacctccccgtgaccttcaaaccatcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
46655139 |
attctcagtgacatggttcaggcaaaggcactgatgtagtggaggttaagcttgaccacataacaaattttcaacctcgccgtgaccttcaaaccatcct |
46655238 |
T |
|
| Q |
116 |
gatcaccaataaactgttgcccattcttattgtttataggcgaggtttaaaatcttgtgatttctgaaccatt |
188 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46655239 |
gatcactaataaaccgttgcccattcttattgtttataggtgaggtttaaaatcttgtgatttctgaaccatt |
46655311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University