View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_20 (Length: 382)
Name: NF1690_low_20
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 11 - 155
Target Start/End: Complemental strand, 12157957 - 12157813
Alignment:
| Q |
11 |
caaaggtagtggttatggttccaagctcacaaatatcttttcacttgaatttattactgaggcagtcgagggaactacaaagtttagacaggtatgtcga |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||| ||| ||||||||||||| ||| ||||| || |
|
|
| T |
12157957 |
caaaggtagtggttatggttccaggctcataaatatcttttcacttgaatttattacagaggcagtcaaggatactacaaagtttaaacatgtatgatga |
12157858 |
T |
 |
| Q |
111 |
tattttgatcgtattagatttttgttttcacacgtatattgatat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12157857 |
tattttgatcgtattagatttttgttttcacacgtctattgatat |
12157813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 317 - 368
Target Start/End: Original strand, 32373935 - 32373986
Alignment:
| Q |
317 |
aaattccacttaacatatgcacatcatcctcgtctccaccaaggaaaataat |
368 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
32373935 |
aaattccacttaacatacgcacaccatcctcgtctccaccaaggaaaataat |
32373986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 264
Target Start/End: Original strand, 32373647 - 32373685
Alignment:
| Q |
226 |
aaacaacacattttcaccaagtgctttgaactctctctc |
264 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32373647 |
aaacagcacattttcaccaagtgctttgaactctctctc |
32373685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University