View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_33 (Length: 327)
Name: NF1690_low_33
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 16 - 317
Target Start/End: Original strand, 10820846 - 10821153
Alignment:
| Q |
16 |
ctttttcatcgtccttgtcaaactcaacccaccacccttaatggtccca------gcctccaagggtccatccctcttggctaatgttcgtggttcaccc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820846 |
ctttttcatcgtccttgtcaaactcaacccaccagccttaatggtcccactcccagcctctaagggtccatccctcttggctaatgttcgtggttcaccc |
10820945 |
T |
 |
| Q |
110 |
tacaaagatcatgacctctctctccctctccttttctctttgctttaattggactttgtttgcatgtatttactctcatcttaaccacggccttcaatac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820946 |
tacaaagatcatgacctctctctccctctccttttctctttgctttaattggactttgtttgcatgtatttactctcatcttaaccacggccttcaatac |
10821045 |
T |
 |
| Q |
210 |
cttttggtccatattcccacttgtgatcaaaatttaataccttccagattactatatcttatccacaaaatttcatgttgaaaatatttatacacagttt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10821046 |
cttttggtccatattcccacttgtgatcaaaatttaataccttccagattactatatcttatccacaaaatttcatgttgaaaatatttatacacagttt |
10821145 |
T |
 |
| Q |
310 |
cttctcac |
317 |
Q |
| |
|
||| |||| |
|
|
| T |
10821146 |
cttttcac |
10821153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University