View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_38 (Length: 310)
Name: NF1690_low_38
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 296
Target Start/End: Original strand, 23830833 - 23831112
Alignment:
| Q |
17 |
tattaaggattttgtccaatcaaaacaaaacaaaagggggtccattacagttaaaccagttcccacaacatgtcatacaatgaatgtcatgcatgaatca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23830833 |
tattaaggattttgtccaatcaaaacaaaacaaaagggggtccattacagttaaaccagttcccacaacatgtcatacaatgaatgtcatgcatgaatca |
23830932 |
T |
 |
| Q |
117 |
ccatactcaccttccttcgtcccctttacctttcatacgcgtctttactaatacatccaaacttatagtcaagttgctcaactcttttaacaccgttata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23830933 |
ccatactcaccttccttcgtcccctttacctttcatacacgtctttactaatacatccaaacttatagtcaagttgctcaactcttttaacactgttata |
23831032 |
T |
 |
| Q |
217 |
ctcttctgacataatatcttgcttcatgtagtgacactttacattgaagacgtgtcaggtgtccaacacatgctgatgtt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23831033 |
ctcttctgacataatatcttgcttcatgtagtgacactttacattgaagacgtgtcaggtgtccaacacatgttgatgtt |
23831112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 150
Target Start/End: Original strand, 23817378 - 23817416
Alignment:
| Q |
112 |
aatcaccatactcaccttccttcgtcccctttacctttc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
23817378 |
aatcaccatactcaccttccttcgtcccattcacctttc |
23817416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 136
Target Start/End: Original strand, 23826842 - 23826874
Alignment:
| Q |
104 |
catgcatgaatcaccatactcaccttccttcgt |
136 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
23826842 |
catgcatgaatcaccatactcactttccttcgt |
23826874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University