View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_46 (Length: 282)
Name: NF1690_low_46
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 271
Target Start/End: Original strand, 32227433 - 32227686
Alignment:
| Q |
17 |
actaggaaggtgggttcctccattttggtactgagaaagatgaaagtgtgnnnnnnngttctttttgtggttgtcatgacaatgggaggaattgtgtaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32227433 |
actaggaaggtgggttcctccattttggtactaagaaagatgaaagtgtgtttttttgttctttttgtggttgtcatgacaatgggaggaattgtgtaga |
32227532 |
T |
 |
| Q |
117 |
ataaaagagtagtcagtggacatgtttttgtgttcctctctcttgaactaaggttgggactgctctacgatgtattgtttataatttttggtggataaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32227533 |
ataaaagagtagtcagtggacatgtttttgtgttcctctctcttgaac-aaggttgggactgctctacgatgtattgtttataatttttggtggataaca |
32227631 |
T |
 |
| Q |
217 |
tctacataaattatcttgaatgtttcagtatagatcgtttgatgttaaagttcat |
271 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32227632 |
tctacataaattatcttgaatgttccagtatagatcgtttgatgttaaagttcat |
32227686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University