View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_58 (Length: 255)
Name: NF1690_low_58
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_58 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 42124751 - 42124509
Alignment:
| Q |
1 |
catgttcgtgaagcagtgtggaattcgctaagacatgctgactcgtatgccgaaatgcattactactcaaactattgcaggctcatgcggttcgaagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42124751 |
catgttcgtgaagcagtgtggaattcgctaagacatgctgactcgtatgccgaaatgcattactactcaaactattgcaggctcatgcggttcgaagatg |
42124652 |
T |
|
| Q |
101 |
gacaacaaatgtatgtgaaattcaagttaaggcctcatgacaccagcatcagtgaagacaaaggtaaagttaatccgacagggattctgccaccagagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42124651 |
gacaacaaatgtatgtgaaattcaagttaaggcctcatgacaccagcatcagtgaagacaaaggtaaagttaatccgacagggattctgccaccagagac |
42124552 |
T |
|
| Q |
201 |
aggtgcaattgctagagatgaaaatgattcacgtcctttgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42124551 |
aggtgcaattgctagagatgaaaatgattcacgtcctttgctt |
42124509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University