View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_63 (Length: 252)
Name: NF1690_low_63
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 41001500 - 41001714
Alignment:
| Q |
1 |
agatagggatatcaccatcatacgccgcataatggtggtctaaggcatatgattaacgttatacaaatttgcaacaaggttcaggtgatgtgggaaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41001500 |
agatagggatatcaccatcatacgccgcaaaatggtggtctaaggcatatgattaacgttatacaaatttggaacaaggttcaggtgatgtgggaaaatt |
41001599 |
T |
|
| Q |
101 |
ggtctacaactcaagggatgtctgaccaatgcaatctgtc--ataagtttttgatgttgctc---cttgcatccaaaattatttacttaatcaaacaagt |
195 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41001600 |
ggtctacaactcaagggatgtctgaacaatgcaatctgtcatataagtttttgatgttgctccttcttgcatccaaaattatttacttaatcaaacaagt |
41001699 |
T |
|
| Q |
196 |
cgattttaatctgat |
210 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41001700 |
cgattttaatctgat |
41001714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University