View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_70 (Length: 245)
Name: NF1690_low_70
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 44607330 - 44607542
Alignment:
| Q |
15 |
aatatcattaagcatgagttcacgtgaggtgctttgacgtgccaatctagcagaggcagatcgttgaaccaccctatttgatgaggaggttcgaccatga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44607330 |
aatatcattaagcatgagttcacgtgaggtgctttgacgtgccaatctagcagaggcagatcgttgaaccaccctatttgatgaggaggttcgaccatga |
44607429 |
T |
|
| Q |
115 |
cggttgcaggtagagagggaacggaagggagtggaggccttgtgggggttctttgacgatgaatcaggttcatcgtcattttgagctttgcgaaaggatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
44607430 |
cggttgcaggtagagagggaacggaagggagtggaggccttgtgggggttctttgatgatgaaccgggttcatcgtcattttgagctttgcgaaaggatt |
44607529 |
T |
|
| Q |
215 |
gcatggtaagaat |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44607530 |
gcatggtaagaat |
44607542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University