View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_71 (Length: 243)
Name: NF1690_low_71
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 42814701 - 42814917
Alignment:
| Q |
11 |
tatttttatatttgatttcttaacatgtgtcttatgccataaatcaacatttctaacttgtgcccttaattatgccacaaattaacatttcttttattat |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42814701 |
tatttctatatttgatttcttaacatgtgtcttatgccataaatcaacatttttaacttgtgcccttaattatgctacaaattaacatctcttttattat |
42814800 |
T |
 |
| Q |
111 |
tatttattacgtgttaatttgtcatttaatggtaagaaataacaccgttctaagagccacgcatttattaatgatgtgattattgaatcctctacacggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42814801 |
tatttattacgtgttaatttgtcatttaatgataagaaatgacaccgttctaagagccacgcatttattaatgatgtgattattggatcctctacacggt |
42814900 |
T |
 |
| Q |
211 |
ccaagtcctacaaaact |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42814901 |
ccaagtcctacaaaact |
42814917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University