View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_73 (Length: 241)
Name: NF1690_low_73
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 42124809 - 42125036
Alignment:
| Q |
1 |
gaaatcagcaagagttcgagcataaaatgcatttcctgtttttagtgttaagtcaatgagagtagga---ggagaatcagaagaatctgtagcaggttca |
97 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42124809 |
gaaatcagcaagagttcgagcgtaaaatgcatttcctgtttttagtgttaagtcaatgagagtaggaggaggagaatcagaagaatctgtagcaggttca |
42124908 |
T |
|
| Q |
98 |
tcagaaaatatcctcaaagcagcaccgcgcgcatcaattcttgcatcatcatcagcactcaagctattactatgtcttactatgatagggtagcttttcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42124909 |
tcagaaaatatcctcaaagcagcaccgcgcgcatcaattcttgcatcatcatcagcactcaagctattactatgtcttactatgatagggtagcttttcc |
42125008 |
T |
|
| Q |
198 |
cagggtgaaaaatcttgtgcattggaat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42125009 |
cagggtgaaaaatcttgtgcattggaat |
42125036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University