View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_74 (Length: 238)
Name: NF1690_low_74
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_74 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 41001278 - 41001497
Alignment:
| Q |
19 |
atgcaggtgttctttgccaatgcgtcagcggttaaacaatcctcgcgtcccatatccgaaaaattgttcgttgtccatggatgcagttgaggatgatgcc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
41001278 |
atgcagggattctttgccaatgcgtcagcggttaaacgatcctcgcgtcccatatccgaaaaattgtttgttgtccatggatgcagttgaggacgatgcc |
41001377 |
T |
 |
| Q |
119 |
catatctctcttcattgtaatatcaatatgcagtgttagaaggttgcaagtttgaggttgattgtccaaaattgtgtgcaatgtttacttcaatggagtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41001378 |
catatctctcttcattgtaatatcaatatgcagtgttagaaggttgcaagtttgaggttgattgtccaaacttgtgtgcaatgtttacttcaatggagtt |
41001477 |
T |
 |
| Q |
219 |
tctgttgcttgacacatcct |
238 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
41001478 |
tgtgttgcttgacacatcct |
41001497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University