View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_83 (Length: 227)
Name: NF1690_low_83
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_83 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 6582392 - 6582594
Alignment:
| Q |
15 |
cataggttcgagtcactgcaagataaccataaactagttattgtttcacttcgacgtaaccggaatattagtcttatctagccccatcgtatatataac- |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6582392 |
cataggttcgagtcactgcaagataaccataaactagttattgtttcactccgacgtaaccggaatattagtcttatctagccccatcgtataaataaca |
6582491 |
T |
 |
| Q |
114 |
-------nnnnnnntcaaatatacaccaaagagaatttcaggtgtgtccaacctggaggattgcaactacagtatgagcacttgtaggactatatgccat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6582492 |
aaaaaaacaaaaattcaaatatacaccaaagagaatttcaggtgtgtccaacctggaggattgcaaccacagtatgagcacttgtaggactatatgccat |
6582591 |
T |
 |
| Q |
207 |
gcg |
209 |
Q |
| |
|
||| |
|
|
| T |
6582592 |
gcg |
6582594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University