View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1690_low_85 (Length: 226)
Name: NF1690_low_85
Description: NF1690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1690_low_85 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 12505221 - 12505026
Alignment:
| Q |
16 |
atgaatggacctggtggcatgttggttttgaagactgttgaattgtatttttgaattctagttgagaagaatttgtctctgcctttgttgtagaaaaagt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
12505221 |
atgaatggacctggtggcatgttggttttgaagactgttgaattgtatttttgtattcttgttgagaagaatttgtctctgccttggttatagaaaaagt |
12505122 |
T |
|
| Q |
116 |
catgtcggtccaaaatcggtccgatgaaagggaggccataggttcctgggatttcttttagtggaagctcttgctggtgattgttgatggtggtgg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12505121 |
catgtcggtccaaaatcggtccgatgaaagggaggccataggttcctgggatttcttttagtggaagctcttgctggtgattgctgatggtggtgg |
12505026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 12490676 - 12490505
Alignment:
| Q |
16 |
atgaatggacctggtggcatgttggttttgaagactgttgaattgtatttttgaattctagttgagaagaatttgtctctgcctttgttgtagaaaaagt |
115 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| |||||| ||||||||||| ||||| |||||||||||||||||||| |||| ||||||||| ||| |
|
|
| T |
12490676 |
atgaagggacctggtggcatgttggttctgaagattgttgagttgtatttttggattcttgttgagaagaatttgtctcttccttggttgtagaagtagt |
12490577 |
T |
|
| Q |
116 |
catgtcggtccaaaatcggtccgatgaaagggaggccataggttcctgggatttcttttagtggaagctctt |
187 |
Q |
| |
|
| |||||||| || ||||||||||||||||||||||||||| | |||||||||| ||||||||| ||||||| |
|
|
| T |
12490576 |
cgtgtcggtcgaagatcggtccgatgaaagggaggccatagctgcctgggatttgttttagtgggagctctt |
12490505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University