View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691-Insertion-11 (Length: 144)
Name: NF1691-Insertion-11
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691-Insertion-11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 25172325 - 25172217
Alignment:
| Q |
8 |
gaacttgtgttagaaactggctatgatggaaatctaagcgaggtaagttgtagtagtattatacatacactatcattgatgtgttttcagttcgctggca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25172325 |
gaacttgtgttagaaactggctatgatggaaatctaagcgaggtaagttgtagta---ttatacatacactatcattgatgtgttttcagttcgctggca |
25172229 |
T |
 |
| Q |
108 |
taacaatttggc |
119 |
Q |
| |
|
||| |||||||| |
|
|
| T |
25172228 |
taaaaatttggc |
25172217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University