View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1691-Insertion-8 (Length: 291)
Name: NF1691-Insertion-8
Description: NF1691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1691-Insertion-8 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 66849 - 67082
Alignment:
| Q |
7 |
agttatccccatgggatgtataggctgacatcactactagttagaaatgcaaacag-ttaaattacaaaactttcatatctgagactctcataaccccca |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
66849 |
agttatccccatgggatgcataggctgacatcactactagttagaaatgcaaacaggttaaattacaaaactttcatatctgagactc--ataaccccca |
66946 |
T |
|
| Q |
106 |
acaactaatataaagaaaaggtccactagaaatagtccaacatcgatagaaagaagtagtgtcatactgtatataattttcaaagtgtcttcttagattg |
205 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||| | | |||| |
|
|
| T |
66947 |
acaactaatataa-gaaaaggtccaccagaaatagtcccacatcgatagaaagaagtagtgtcatactctatataattctcaaagtgtctaatcaaattg |
67045 |
T |
|
| Q |
206 |
tagcaatcagatgattgtgtgaattattaagttgatt |
242 |
Q |
| |
|
| ||||| || || ||||||||||||||||||||||| |
|
|
| T |
67046 |
tggcaattaggtggttgtgtgaattattaagttgatt |
67082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University