View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16910_low_3 (Length: 293)
Name: NF16910_low_3
Description: NF16910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16910_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 8e-95; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 11 - 194
Target Start/End: Original strand, 16462118 - 16462301
Alignment:
| Q |
11 |
caaaggggtgtcatggttgtgtgttcagctggaaatgatggtcctgatcattacactgttgtcaacacagcaccatggatatttacggttgcagcctcta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16462118 |
caaaggggtgtcatggttgtgtgttcagctggaaatgaaggtcctgatcattacactgttgtcaacacagcaccatggatatttacggttgcagcctcta |
16462217 |
T |
 |
| Q |
111 |
atatcgataggaatttccagtcaactgttgtccttggaaacggaaaatcttataaagtaagtttcttgatctccaagccaaaag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16462218 |
atatcgataggaatttccagtcaactgttgtccttggaaacggaaaagcttataaagtaagtttcttgatctccaagccaaaag |
16462301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 11 - 183
Target Start/End: Original strand, 16492024 - 16492196
Alignment:
| Q |
11 |
caaaggggtgtcatggttgtgtgttcagctggaaatgatggtcctgatcattacactgttgtcaacacagcaccatggatatttacggttgcagcctcta |
110 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |||||||||||||||| | |||| ||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
16492024 |
caaaggggggtcacggttgtgtgttcagctgggaatgatggtcctgatcctaacacagttgtcaacacagcaccatggatatttacagttgcagcttcta |
16492123 |
T |
 |
| Q |
111 |
atatcgataggaatttccagtcaactgttgtccttggaaacggaaaatcttataaagtaagtttcttgatctc |
183 |
Q |
| |
|
|||| |||||||| || ||||||||| ||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
16492124 |
atattgataggaactttcagtcaactattgtccttggaaatggaaaaagtttccaagtaagtttcttgatctc |
16492196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 192 - 278
Target Start/End: Original strand, 16462340 - 16462426
Alignment:
| Q |
192 |
aagcacaaacactagacactgatatgtagacaccgatattaatcaaagaaaacataactgtcagatacttaacacatgttggatatt |
278 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16462340 |
aagcacaaacactagacactgatatttagacaccgatattaatcaaagaaaacataactgtcagatacttaacacatgttggatatt |
16462426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University