View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16911_high_2 (Length: 211)
Name: NF16911_high_2
Description: NF16911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16911_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 29653347 - 29653527
Alignment:
| Q |
18 |
tatcttagtgaaaatttgatggaaaggtgtcgtgagcagatcaaaattttgcatctgccagtttgggctcacattgaagaacactattatgatgatgatg |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29653347 |
tatcttagtgaaaatttgagggaaaggtgtcgtgagcagatcaaaattttgcatctgccagtttgggctcacattgaagaacactattatgatgatggtg |
29653446 |
T |
|
| Q |
118 |
tttaccttaagatgtttttaaataatgaaatatataatgtctttgtttgattctgagtggtggaggtgtaaggttattttctt |
200 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29653447 |
tttatcttgagatgtttttaaataatgaa--atataatgtctttgtttgattccgagtggttgaggtgtaaggttattttctt |
29653527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 151
Target Start/End: Original strand, 29681699 - 29681825
Alignment:
| Q |
26 |
tgaaaatttgatggaaaggtgtcgtgagcagatcaaaattttgcatctgccagtttgggc-tcacattgaagaacactattatgatgatgatgtttacct |
124 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||| ||||| ||| ||||| || | || |||||||||||||||||||||||| || |||| || |
|
|
| T |
29681699 |
tgaaaatttgaaggaaaggtgtcatgagaagatcaaaaatttgcggctgtcagttaggccctcgtattgaagaacactattatgatgatcatatttatct |
29681798 |
T |
|
| Q |
125 |
taagatgtttttaaataatgaaatata |
151 |
Q |
| |
|
| |||||| ||||||| |||||||||| |
|
|
| T |
29681799 |
tgagatgtatttaaatgatgaaatata |
29681825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University