View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_high_16 (Length: 476)
Name: NF16912_high_16
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 412 - 463
Target Start/End: Original strand, 42301277 - 42301327
Alignment:
| Q |
412 |
taaattggaatttttaaataaataaatccccccttctttttccccattattc |
463 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42301277 |
taaattggaatttttaaataaataaat-cccccttctttttccccattattc |
42301327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University