View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_high_29 (Length: 386)
Name: NF16912_high_29
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 268
Target Start/End: Original strand, 45379098 - 45379348
Alignment:
| Q |
19 |
acgtagttgcatggacactgccagaaccctgtgnnnnnnn-ccttgttcgtttggcataaattataacattatttttacaaagggagttttgagtcttac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45379098 |
acgtagttgcatggacactgccagaaccctgtgttttttttccttgttcgtttggcataaattataacattatttttacaaagggagttttgagtcttgc |
45379197 |
T |
|
| Q |
118 |
taaatatttataaactctaataacttggtgaattaaatatcgcattcagttgagagaagtgttaacattttagtgtggcgaataaatatcgcattcaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379198 |
taaatatttataaactctaataacttggtgaattaaatatcgcattcagttgagagaagtgttaacattttagtgtggcgaataaatatcgcattcaatt |
45379297 |
T |
|
| Q |
218 |
gagagaagtgttgccgtgtctcaaaaaatatcactttcaagataagttata |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379298 |
gagagaagtgttgccgtgtctcaaaaaatatcactttcaagataagttata |
45379348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University