View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_high_50 (Length: 290)
Name: NF16912_high_50
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 28 - 263
Target Start/End: Complemental strand, 22446345 - 22446099
Alignment:
| Q |
28 |
tttgtactaactactatcaatatatactctaatagtcacttttttggacgtgtatcaatattatatatatttgtaa-----------tagctagatacgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22446345 |
tttgtactaactactatcaatatatactctaatagtcacttttttggacgtgtatcaatattatatatatttgtaaaatatttgtaatagctagatacgt |
22446246 |
T |
 |
| Q |
117 |
aaataaaacactaaactcttgattgacaatatgatcaatatatttatgatgatgcccctgacttattgaattggtcataataatgctttaagtccttctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22446245 |
aaataaaacactaaactcttgattgacaatatgatcaatatatttatgatgatggccctgacttattaaattggtcataataatgctttaagtccttctt |
22446146 |
T |
 |
| Q |
217 |
aagggatatcacacgttttcatattttggatgacttgaaagttttct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22446145 |
aagggatatcacacgttttcatattttggatgacttgaaagtgttct |
22446099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University