View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16912_high_63 (Length: 244)

Name: NF16912_high_63
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16912_high_63
NF16912_high_63
[»] chr4 (2 HSPs)
chr4 (72-244)||(48706673-48706846)
chr4 (7-74)||(48707561-48707623)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 72 - 244
Target Start/End: Complemental strand, 48706846 - 48706673
Alignment:
72 taaatatttttgttttgttatccgcacttccttccaagtccaacactcccattttctacaactagatgcaggaaggaatcgcacgtaaatactatatcaa 171  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||| |||||||||    
48706846 taaatatttttgttttgttaaccgcacttccttccaagtccaacactcccattttctataactatatgcatgaaggaatagcacgtaaattctatatcaa 48706747  T
172 gaagtctttgttcacaaaatatcatgaaacacgttacggtttaaataaatcaa-ttttcttttgggtcgatgga 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
48706746 gaagtctttgttcacaaaatatcatgaaacacgttacggtttaaataaatcaatttttcttttgggtcgatgga 48706673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 7 - 74
Target Start/End: Complemental strand, 48707623 - 48707561
Alignment:
7 tatgtgtgaaggtttgtccctcatctacagagcagcatttcaaatgcagtttgtttgtttgaccttaa 74  Q
    |||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||    
48707623 tatgtgtgaaggtttgtccctcatctacagagcagcatt-----tgcagtttgtttgtttgaccttaa 48707561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University