View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16912_high_65 (Length: 240)

Name: NF16912_high_65
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16912_high_65
NF16912_high_65
[»] chr6 (1 HSPs)
chr6 (1-221)||(19641265-19641485)


Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19641265 - 19641485
Alignment:
1 tgaagaaaacaatgtctgtttatgattcctttgcagtgggatgatgtaactccgaaaccaacattatctgttagcttgggtcagaactcaggtgtacaca 100  Q
    |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
19641265 tgaagaaaacaatgtctgtttatgattcctttgcagtcagatgatgtaactccgaaaccaacattatctgttagcttgggtcagaactcaggtctacaca 19641364  T
101 tgatatcccgcagtgagcagattccccgccgttcaaagcgtcttgctggaattaaggcagatcaacttaaaacaactcgagcgaatcaagatgtggttaa 200  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19641365 tgatatcctgcagtgagcagattccccgccgttcaaagcgtcttgctggaattaaggcagatcaacttaaaacaactcgagcgaatcaagatgtggttaa 19641464  T
201 acaatcgggcgaggacaaaac 221  Q
    |||||||||||||| ||||||    
19641465 acaatcgggcgagggcaaaac 19641485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University