View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_high_67 (Length: 238)
Name: NF16912_high_67
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 154 - 220
Target Start/End: Complemental strand, 19190286 - 19190220
Alignment:
| Q |
154 |
tccataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataacgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190286 |
tccataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataacgt |
19190220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University