View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_high_69 (Length: 237)
Name: NF16912_high_69
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_high_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 18 - 133
Target Start/End: Complemental strand, 42236246 - 42236131
Alignment:
| Q |
18 |
aggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataagtgtttcttggattgtccaattacctttacggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236246 |
aggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataagtgtttcttggattgtccaattacctttacggta |
42236147 |
T |
|
| Q |
118 |
ttctctggtggaggag |
133 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
42236146 |
ttctctggaggaggag |
42236131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 221
Target Start/End: Complemental strand, 41537676 - 41537581
Alignment:
| Q |
126 |
tggaggagcagagggtggttatttgggaaggtgaggtggcggattggatggtggagacgagttcttgggatttagtgacggaatctagggtgtagg |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41537676 |
tggaggtgcagagggtggttatttgggaaggtgaggtggcggattggatggtggagacgagttcttgggatttagtgacggaatctagggtgtagg |
41537581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 217
Target Start/End: Original strand, 17402575 - 17402637
Alignment:
| Q |
155 |
ggtgaggtggcggattggatggtggagacgagttcttgggatttagtgacggaatctagggtg |
217 |
Q |
| |
|
|||| |||||||||||||||||| |||| ||| ||||||||||| | |||| |||||| |||| |
|
|
| T |
17402575 |
ggtgtggtggcggattggatggttgagaggaggtcttgggatttggagacgaaatctaaggtg |
17402637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University