View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_high_74 (Length: 227)
Name: NF16912_high_74
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_high_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 32400718 - 32400921
Alignment:
| Q |
10 |
acatcatcatgtgagtgaggaaccaagtgcacgtttattttgtctgggataatcctctgtgtgatgttgtattctatgtactctgaattcactacatgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400718 |
acatcatcatgtgagtgaggaaccaagtgcacgtttattttgtctgggataatcctctgtgtgatgttgtattctatgtactctgaattcactacatgaa |
32400817 |
T |
 |
| Q |
110 |
tcacagccaccaaaacggtgaatagcaccaccgtattgatcatcatcactatggtgagtgagttggttctgagttttggttttaatattacttactgaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32400818 |
tcacagccaccaaaacggtgaatagcaccaccgtattgatcatcatcactatggtgagtgagttggttctgagttttggttttaatattacttactgaat |
32400917 |
T |
 |
| Q |
210 |
tagg |
213 |
Q |
| |
|
|||| |
|
|
| T |
32400918 |
tagg |
32400921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University