View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16912_low_18 (Length: 476)

Name: NF16912_low_18
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16912_low_18
NF16912_low_18
[»] chr5 (1 HSPs)
chr5 (412-463)||(42301277-42301327)


Alignment Details
Target: chr5 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 412 - 463
Target Start/End: Original strand, 42301277 - 42301327
Alignment:
412 taaattggaatttttaaataaataaatccccccttctttttccccattattc 463  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||    
42301277 taaattggaatttttaaataaataaat-cccccttctttttccccattattc 42301327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University