View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_19 (Length: 472)
Name: NF16912_low_19
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-153; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 2332478 - 2332167
Alignment:
| Q |
1 |
aaattttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagttacaggcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2332478 |
aaattttgtaaaatatcggttgaaatccatcatgtcctagggctttgtaagagtgcatagggaaaatagaatctttaatcctttccatagtgacaggcaa |
2332379 |
T |
|
| Q |
101 |
gagaagctggtccatcaagttaatgctaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattggaatagattcat |
200 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
2332378 |
gagaagctggtccatcaagctaatgccaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgattgggatagatgcat |
2332279 |
T |
|
| Q |
201 |
aaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtcgtcttctgatgatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2332278 |
aaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcacc--atgttttccacattcaaaccagaaattttatttcgccgtcttctgatgatg |
2332181 |
T |
|
| Q |
301 |
gcctgcgtatataa |
314 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
2332180 |
gcctgcgtgtataa |
2332167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 397 - 456
Target Start/End: Complemental strand, 2332085 - 2332026
Alignment:
| Q |
397 |
ttgcttatggcttttgcacatataaaacgttttgatccttgtctccccacaatcgtttct |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332085 |
ttgcttatggcttttgcacatataaaacgttttgatccttgtctccccacaatcgtttct |
2332026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University