View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16912_low_45 (Length: 330)
Name: NF16912_low_45
Description: NF16912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16912_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 221 - 322
Target Start/End: Complemental strand, 45724695 - 45724594
Alignment:
| Q |
221 |
caatcacataaagtgctcatgaaataattttacgtatgtgtctgtgtggattggatggtatcgtataacgtatgtatatactataaatgatttatgatga |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45724695 |
caatcacataaagtgctcatgaaataattttacgtatgtgtctgtgtggattggatggtatcgtataacgtatgtatatactataaatgatttatgatga |
45724596 |
T |
|
| Q |
321 |
tg |
322 |
Q |
| |
|
|| |
|
|
| T |
45724595 |
tg |
45724594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 93 - 188
Target Start/End: Complemental strand, 45724819 - 45724724
Alignment:
| Q |
93 |
gcagtgatacaactcagttaatttcttttccctataaaattacccactcatgggaattctcttttggtcgtggtctaatgctatcattagttgtac |
188 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45724819 |
gcagtgatacaactctgttaatttcttttccctagaaaattacccactcatgggaattctcttttggtcgtggtctaatgctatcattagttgtac |
45724724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 45724885 - 45724853
Alignment:
| Q |
32 |
ttactgcatgaatcggtgtactgcactgcatgc |
64 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
45724885 |
ttactgcatgaatcggtgcactgcactgcatgc |
45724853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University